Stock B6.129P2-Mbd3<tm2Blh>/H

FESA Number


Strain Name


Mutation Strain Type

Mutation Type Mutation Subtype Strain Type
IMSR - Targeted mutation IMSR - mutant stock


Institution name Depositor / Originator Name
University of Cambridge Originator Retained
University of Cambridge Depositor Retained

Gene/Allele Information

Allele Name Allele MGI ID Gene Name Gene MGI ID Chromosome
Mbd3<tm2Bh> MGI:4887391 Mbd3 MGI:1333812 10

Phenotypic Description

No abnormal phenotype observed, however, homozygotes for the deleted allele die early post implantation. Genotyping protocol: Mbd3P36: ACTGCTCCAGCTTGGTACAG Mbd3P46: AATCAGATCACTTCAGCTCC Mbd3P37: CGAAACCATGATAAAGTCCC Wild type allele: Mbd3p36/46: 250bp Floxed allele: Mbd3p36/46: 290bp Recombined allele: Mbd3p36/37: 180bp PCR Conditions: 94°C, 2 minutes Then 30 cycles of: 94°C, 10 seconds 60°C 10 seconds 72°C 30 seconds Followed by 2 minutes at 72°C




Genetic Status


Background Strain Name


Background Strain MGI ID



For more information or to order stocks, Contact us