Title Phenotype Contact
B6.129P2-Cited2<tm1Bha>/BhaH Cardiac malformations, adrenal agenesis, fusion of cranial ganglia, abnormal cardiac neural crest migration, excencephaly and left-right patterning defects. Contact
B6.129P2-Efnb1<tm1Rha>/Rha Knockout mice exhibit omphalocele, mispaired sternabrae, palate abnormalities, skull abnormalities, females additionally exhibit polysyndactyly. Contact
B6.129P2-Ehmt2<Gt(ES62)Feil>/H Homozygotes are embryonic lethal at ~8.5 dpc. Show retardation of growth, abnormal imprinting and open neural tube. Contact
B6.129P2-Grin1<tm1Slab>/H Heterozygous animals have subregion-specific impairment of hippocampal plasticity, associated with impaired spatial memory and navigation. Homozygeous animals (neo/neo) die shortly after birth. Heterozygous animals with heterozygous global Cre-mediated removal of the neo cassette (Grin1<tm1.1Slab>) die shortly after birth. Therefore the Grin1<tm1.1Slab> allele cannot be maintained. Contact
B6.129P2-Grin1<tm2Slab>/H The allele behaves as a Grin1 null allele. Homozygous animals die shortly after birth. Grin1 expression may potentially be induced by tTA or rtTA. Knocked-in tTA DNA segment apparently inactive. Contact
B6.129P2-Mbd3<tm2Blh>/H No abnormal phenotype observed, however, homozygotes for the deleted allele die early post implantation. Genotyping protocol: Mbd3P36: ACTGCTCCAGCTTGGTACAG Mbd3P46: AATCAGATCACTTCAGCTCC Mbd3P37: CGAAACCATGATAAAGTCCC Wild type allele: Mbd3p36/46: 250bp Floxed allele: Mbd3p36/46: 290bp Recombined allele: Mbd3p36/37: 180bp PCR Conditions: 94°C, 2 minutes Then 30 cycles of: 94°C, 10 seconds 60°C 10 seconds 72°C 30 seconds Followed by 2 minutes at 72°C Contact
B6.129P2-Nat2<tm1Esim>/H None. Contact
B6.129P2-Nr1d2<tm1Dgen>/H No visible phenotype. Contact
B6.129P2-Nr1d2<tm1Dgen>/H No visible phenotype. Contact
B6.129P2-Psip1<Gt(betageo)1Hgs>/H Perinatal lethal, homozygotes have homeotic transformations and abnormal ribcage. Contact
B6.129P2-Scn10a<tm1Jnw>/JnwH Defects in mechanical and inflammatory pain tests. Contact
B6.129P2-Slc38a4<tm2Kel>/Kel None, a minor effect on term weight. Contact
B6.129P2-Tacr1/H Deletion of NK1 receptor gene. Viable, normal breeding pattern. No obvious phenotype. Contact
B6.129P2-Tacr1<tm1Sph>/H Deletion of NK1 receptor gene. Viable, normal breeding pattern. No obvious phenotype. Contact
B6.129P2-Tg(EEF1A1-Socs6)1Pwg/H 10% increased body weight & increased insulin sensitvity. Contact
B6.129P2-Tln1<tm1Crit>/CritH Contact
B6.129P2-Tln1<tm4.1Crit>/Crit The homozygous floxed Tln1 mice are viable and fertile and have no phenotype. Contact
B6.129P2-Trpc4<tm1Dgen>/H No visible phenotype. Contact
B6.129P2-Wt1<tm1Hst>/H No detectable WT* protein isoforms by western blot. No overt phenotype. Contact
B6.129P2-Zfp647<Gt(ES492)Hgs>/H Homozygotes are embryonic lethal at before 6.5 dpc. Contact

Pages