Title Phenotype Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:3053096 Scn10a<tm2(cre)Jnw> MGI:108029 Scn10a
No phenotype in heterozygotes. Some pain deficits in homozygotes. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:4358373 Tln2<tm2Crit> MGI:1917799 Tln2
The homozygous Tln2(cd) mice are viable and fertile, and exhibit no evidence of any phenotype. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:5310741 Igf2<tm4.1Wrk> MGI:96434 Igf2
Loss of Igf2 imprinting. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:2181904 Dazl<tm1Hjc> MGI:1342328 Dazl
Mice homozygous for this mutation in this background lack germ cells at birth in both sexes. Heterozygous mice show close to normal fertility. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:3831364 Fgfr3<tm1.1Aomw> MGI:95524 Fgfr3
All homozygous males, some homozygous females and some heterozygous males develop an abnormal skull phenotype sometimes with malocclusion, and may be smaller in size. The phenotype is not fully penetrant. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:3038876 Il1rn<tm1Nick> MGI:96547 Il1rn
Strain resistant to arthritis, arteritis and psoriasis (seen in BALB/c) but highly susceptible to undefined 'malaise' under conventional conditions. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:3581680 Tlx1<tm1Thr> MGI:98769 Tlx1
Asplenia. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:2179740 Cited2<tm1Bha> MGI:1306784 Cited2
Cardiac malformations, adrenal agenesis, fusion of cranial ganglia, abnormal cardiac neural crest migration, excencephaly and left-right patterning defects. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:3653699 Efnb1<tm1Rha> MGI:102708 Efnb1
Knockout mice exhibit omphalocele, mispaired sternabrae, palate abnormalities, skull abnormalities, females additionally exhibit polysyndactyly. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:3772197 Ehmt2<Gt(ES62)Feil> MGI:2148922 Ehmt2
Homozygotes are embryonic lethal at ~8.5 dpc. Show retardation of growth, abnormal imprinting and open neural tube. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:2655224 Grin1<tm1Slab> MGI:95819 Grin1
Heterozygous animals have subregion-specific impairment of hippocampal plasticity, associated with impaired spatial memory and navigation. Homozygeous animals (neo/neo) die shortly after birth. Heterozygous animals with heterozygous global Cre-mediated removal of the neo cassette (Grin1<tm1.1Slab>) die shortly after birth. Therefore the Grin1<tm1.1Slab> allele cannot be maintained. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:2655237 Grin1<tm2Slab> MGI:95819 Grin1
The allele behaves as a Grin1 null allele. Homozygous animals die shortly after birth. Grin1 expression may potentially be induced by tTA or rtTA. Knocked-in tTA DNA segment apparently inactive. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:4887391 Mbd3<tm2Bh> MGI:1333812 Mbd3
No abnormal phenotype observed, however, homozygotes for the deleted allele die early post implantation. Genotyping protocol: Mbd3P36: ACTGCTCCAGCTTGGTACAG Mbd3P46: AATCAGATCACTTCAGCTCC Mbd3P37: CGAAACCATGATAAAGTCCC Wild type allele: Mbd3p36/46: 250bp Floxed allele: Mbd3p36/46: 290bp Recombined allele: Mbd3p36/37: 180bp PCR Conditions: 94°C, 2 minutes Then 30 cycles of: 94°C, 10 seconds 60°C 10 seconds 72°C 30 seconds Followed by 2 minutes at 72°C Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:2675637 Nat2<tm1Esim> MGI:109201 Nat2
None. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:5427681 Nr1d2<tm1Dgen> MGI:2449205 Nr1d2
No visible phenotype. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:5427681 Nr1d2<tm1Dgen> MGI:2449205 Nr1d2
No visible phenotype. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:3664569 Psip1<Gt(betageo)1Hgs> MGI:2142116 Psip1
Perinatal lethal, homozygotes have homeotic transformations and abnormal ribcage. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:2180183 Scn10a<tm1Jnw> MGI:108029 Scn10a
Defects in mechanical and inflammatory pain tests. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:5763185 Slc38a4<tm2Kel>              
None, a minor effect on term weight. Contact
Allele MGI ID Allele Name Gene MGI ID Gene Name
MGI:2182395 Tacr1<tm1Sph> MGI:98475 Tacr1
Deletion of NK1 receptor gene. Viable, normal breeding pattern. No obvious phenotype. Contact
